Warning: fopen(/home/virtual/audiology/journal/upload/ip_log_2022-01.txt): failed to open stream: Permission denied in /home/virtual/lib/view_data.php on line 73 Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 74 Expression of Phosphlipase C-β1 and Phosphlipase C-γ1 on Cholesteatoma
Korean J Audiol Search

CLOSE


Anatomy and physiology
Korean Journal of Audiology 1999;3(1):30-36.
Expression of Phosphlipase C-β1 and Phosphlipase C-γ1 on Cholesteatoma
Young Ho Song, Nam Pyo Hong, Yong Bum Kim, Kun Hee Lee, Hwoe Young Ahn, Chang Il Cha
Department of Otolaryngology, College of Medicine, Kyung Hee University, Seoul, Korea
중이진주종에서의 Phosphlipase C-β1과 Phosphlipase C-γ1의 발현
송영호, 홍남표, 김용범, 이건희, 안회영, 차창일
경희대학교 의과대학 부속병원 이비인후과학교실
Abstract

Signal transduction through phospholipase C (PLC) participating in the regulation of epidermal cell growth and differentiation has been known. EGF, PDGF, and TGF-α binding to their receptors induces tyrosine phosphorylation of phospholipase C-γ1 (PLC-γ1). PLC-γ1 is a substrate for several receptor tyrosine kinases and its catalytic activity is increased by tyrosine phosphorylation. Tyrosine kinase phosphorylation of PLC-γ1 stimulates PLC activation and cell proliferation. And we reported that overexpression of PLC-β1 protein and PLC-γ1 protein, and downregulation of PKC isozymes on cholesteatoma. However the signal transduction pathway and significance of PLC in cholesteatoma is unknown. To provide evidence PLC role in proliferating cholesteatoma. We investigated the quantity of PLC-β1 protein and PLC-γ1 protein, and PLC-β1 RNA and PLC-γ1 RNA, in posterior auricular skin and cholestsatoma. 20 cholestsatoma specimens were obtained from operated patients for western blotting, RT-PCR, and densitometry. Western blot analyses revealed that PLC-β1 protein and PLC-γ1 protein in cholesteatoma were readily detectable and considerable higher levels of these were detectable compared with posterior auricular skin. On PCR and densitometry for PLC-β1 and PLC-γ1, there was no difference in the PLC RNAs level between posterior auricular skin and cholesteatoma. The results suggest that there are signal transduction pathway through PLC, over-expression of PLC protein on post-transcription level. So signal transduction pathway through PLC over-expression at posttranscription and PKC downregulation at posttranscription could be an important pathogenesis of cholesteatoma. 

Keywords: Cholesteatoma;Signal transduction;Phospholipase C (PLC);Phospholipase C-β1(PLC-β1);Phospholipase C-γ1 (PLC-γ1).
서론 진주종성 중이염은 만성적인 염증과 재발, 주위 골조직을 파괴하여 심한 난청 및 치명적인 두개내 합병증을 초래하는 질환으로 그 발생기전 및 병태생리학적 현상은 그동안 많은 관심과 연구대상이 되어왔다.1)2) 신호전달과정은 외부의 신호가 일차전달물질(first messenger)인 각종 성장인자, 신경전달물질 및 호르몬 등에 의해 세포막에 있는 각각의 독특한 수용체와 결합하고 또한 이러한 결합에 의하여 세포내로 정보가 전달되며 수용체분자의 입체구조에 변화가 초래되어 intracellular domain의 tyrosine kinase가 활성화된다. Protein kinase C(이하 PKC로 약함), phospholipase C(이하 PLC로 약함), G 결합단백질, adenyl cyclase 등의 활성과 세포내의 inositol triphosphate(이하 PIP 3로 약함), c-AMP, diacylglcerol(이하 DAG로 약함), Ca2+ 등의 이차전달물질(second messenger)로 이온교환 세포골격의 재배열, 지질막의 변화 및 단백합성 등의 일련의 생화학적 반응을 유도하여 세포의 변화, 세포의 과증식, 종양화 변환, 세포이주개시 및 조직호르몬의 분비를 유발하는 과정으로 알려져있다.3-5) PLC는 epithelial growth factor receptor(이하 EGFR로 약함)이나 platelet-derived growth factor receptor(이하 PDGFR로 약함)와 같은 receptor protein tyrosine kinase의 기질로 phosphatidyl inositol 4, 5-biphosphate(이하 PIP 2로 약함)를 PIP 3와 DAG로 가수분해하여 PKC활성 및 Ca2+의 대사조절, c-fos와 c-myc의 발현 등의 DNA변화와 세포의 분화 및 세포의 종양화변환을 유발하고 arachidonicacid의 생성에도 관여하는 이차전달물질로 알려지고 있다.4)6-11) 저자들은 이전 연구들에서 면역조직화학검사로 중이진주종상피에서 PLC-β1 단백질과 PLC-γ1 단백질의 과발현이 있음을 보고하여 중이진주종상피는 기저층에서는 PLC-β1을, 상부층들 에서는 PLC-β1와 PLC-γ1 을 매개로 하는 신호전달과정이 존재한다고 보고하였다.12) 그리고 중이진주종상피에서 PLC 이후의 신호전달과정중 PKC 동위효소가 후전사단계에서 하향조절(downregualtion)됨을 보고 한 바 있다.13) 이에 저자들은 세포의 성장과 분화에 관여하는 여러 신호전달인자들을 규명하는 것이 중요하다고 생각되어 중이진주종조직에서 일어나고 있는 과증식의 성향과 PLC 동위효소와 PKC 동위효소를 매개로 하는 신호전달과정를 이해하고 면역조직화학검사로 중이진주종상피에서 PLC-β1 단백질과 PLC-γ1 단백질의 과발현을 검정하기 위하여 단세포항체를 이용한 western blot 분석을 통하여 PLC 단백질의 변화를 관찰함은 물론 역전사효소중합반응과 발현된 PLC RNA 산물의 농도를 측정하여 중이진주종에서의 PLC의 동위효소의 변화를 관찰함으로써 중이진주종에서의 PLC의 역할을 알아보기 위해 본 연구를 실시하였다. 대상 및 방법 조직표본 실험에 사용한 조직은 1996년 9월부터 1997년 6월까지 경희대학교 의과대학 부속병원 이비인후과학교실에서 진주종성 중이염으로 수술적 치료를 받은 20세 이상의 성인 20명의 환자로부터 수술시 채취한 중이진주종조직이었다. 음성 대조군으로는 일반 만성중이염으로 진단받은 10명의 환자에서 수술시 이개후부에서 채취한 피부편을, 양성 대조군으로는 10명의 건선환자의 건선부에서 펀치생검한 조직 10편을 사용하였다. 채취한 조직들은 즉시 isopentane 용액에 액침한 후 -70℃에서 보관하여 사용하였다. Western blotting 20례의 중이진주종상피와 대조군인 10례의 이개후부의 피부 및 10례의 건선조직 상피를 각각 EBC 완충용액(40 μM Tris/HCl, pH 8.0, 120 μM NaCl, 0.5% NP-40, 2 μg/ml aprotinine, 2 μg/ml pepstatin, 2 μg/ml leupeptin, 100 μg/ml phenylmethysulfonyl fluoride)을 가한 후 표피파쇄기(Fisher Scientific, Pittsburgh, Philadelphia, U.S.A.)로 분쇄하였다. 분쇄된 조직을 1% SDS(sodium dodecyl sulfate)용액에 반응시킨 후 4℃에서 15,000 rpm으로 15분간 원심분리하여 상층액을 취하였고 순도를 높이기 위해 다시 15,000 rpm에서 15분간 원심분리 후 상층액을 취하였다. 소의 혈청알부민(Sigma, St. Louis, Missouri, U.S.A.)을 표준액으로 하여 각각의 단백질양을 측정 후 1 mg/ml의 단백질이 되게 SDS sample 완충액(100 nM Tris/HCl, pH 6.8, 200 nM dithiothreitol, 4% SDS, 0.2% bromophenol blue, 20% glycerol)을 가하여 100℃에서 5분간 끓여 시료로 사용하였다. 젤은 5% SDS-PAGE를 사용하였고, SDS-PAGE를 시행 한 후 젤을 30분간 transfer 용액으로 평형시키고 membrane을 완충용액에 30분간 평형시켰다. 이후 western blot용 cassette를 이용하여 전기영동으로 분리된 단백질은 nitrocellulose membrane으로 전기적인 방법으로 옮겼고 이후에 membrane을 건조된 여과지에 옮겨놓고 상온에서 건조시켰다. 그 후 membrane에 단백질이 결합되지 않는 부분을 blocking하기 위해 1% 소의 혈청알부민이 포함된 TBST(Tris buffered saline-Triton X-100) 용액 20 ml에 1시간동안 처리하였으며 완충용액을 제거 후 TBST용액으로 membrane을 3회 세척하였다. 1:1,000으로 희석한 PLC-β1 단세포항체(Mouse anti-human PLC-β1, Transduction Laboratories, Lexinton, Kenturky, U.S.A.), PLC-γ1 단세포항체(Mouse anti-human PLC-γ1, Transduction Laboratories, Lexinton, Kenturky, U.S.A.)의 일차항체용액을 각각 4℃에서 membrane에 반응시켰고 항혈청희석용액을 제거 후 TBST용액으로 3회 세척하였다. Goat anti-mouse IgG-alkaline phosphatase를 30분간 실온에서 반응시켰고 10분씩 TBST용액으로 세척한 후 alkaline phosphatase 기질용액을 첨가하여 단백질밴드가 나타날 때까지 진탕하며 반응시켰다. 역전사중합효소반응(RT-PCR) RNA 추출 냉동보관된 조직을 GSS 용액(guanidine isothiocyanate 250 g, 증류수 293 ml, 0.75 M sodium citrate 17.6 ml, 10% sarcosinate 26.4 ml)에 solution D(2-mercaptoethanol 0.1 M 혼합액) 500 μl와 sodium acetate 50 μl(2M, pH4.0)를 혼합 후 water-saturated phenol 500 μl, chloroform과 isoamyl alcohol을 24:1로 혼합한 용액 100 μl를 넣어 10초간 진탕 후 15분간 4℃에서 방치하였다. 혼합용액을 15,000 rpm에서 20분간 원심분리하여 상층액의 4/5를 회수하여 동량의 cold isopropanol 1,000 μl를 넣어 -70℃에서 24시간 침전시켰다. 그 후 15,000 rpm에서 20분간 원심분리하여 용액을 제거한 후 100% 및 70% ethanol로 세척한 후 30 μl의 RNase-free water에 녹여 260 nm에서 densitometer(Pharmacia Biotech, San Francisco, California, U.S.A.)를 이용하여 흡광도를 측정하여 농도를 측정하였다. cDNA 합성 시료를 65℃에서 10분간 보관하였고 미세원침관에 reverse transcriptase 완충액 2 μl에 random hexamer(10 pM) 1 μl, AMV-RT 1 μl(10 U/μl), dNTP 1 μl(10 pM), RNase inhibitor 0.5 μl, RNA 1 μg 및 증류수를 첨가하여 42℃에 15분간 반응시켜 역전사하였고 cDNA를 형성한 후 densitometer를 이용하여 500 ng의 DNA를 얻었다. Polymerase chain reaction House keeping gene은 glyceraldehyde-3-p-dehydrogenase(이하 GAPDH로 약함)를 사용하였고 PLCβ1과 PLCγ1의 특이한 증폭에 사용되는 oligonucleo-tide primer는 각 PKC의 특이한 부위에 따라 DNA sy-nthesizer(Bioneer, Chungwon-koon, Korea)를 이용하였다. DNA primer의 염기서열은 PLC β1의 sense는 5' CGGGGCAGCTGGCTGGGACC 3', antisense는 5' GAGTCCACAT GGTTCTCGAA 3'로 220 bp이며 PLC γ1의 sense는 5' ATGGCG GG-CGCCGCGTCCCC 3', antisense는 5' CCTGGG-TCGAAAGGCC GGCC 3'로 302 bp이다. 10× amplification 완충액 10 μl, dNTP 혼합용액 5 μl(10 pM), 2 μl의 GAPDH primer 1(10 pM), 2 μl의 GAPDH primer 2(10 pM), template c-DNA 4 μl, H2O 77 μl 등의 반응혼합물과 각 c-DNA를 혼합 후 GAPDH primer를 이용하여 한 주기마다 94℃에서 1분간 denaturation과 59℃에서 1분간 annealing, 72℃에서 1분간 polymerization을 시행하여 이런 과정을 30회 반복하였고 마지막 주기는 72℃에서 10분간 polymerization을 시행하여 DNA를 증폭 하였다. 최종 추출물 10 μl를 2% agarose gel에 100volt로 10분간 전기영동을 시행하고 densitometer 를 이용하여 각 밴드의 밝기를 정량화하였다. 1차 PCR 반응의 결과를 토대로 RNA의 양을 증감하여 모든 GAPDH PCR products의 양을 ±10%내로 정량화하였고 target 유전자에 대한 PCR 반응을 시행하여 상대적인 정량화를 시행하였다. 처음 주기는 94℃로 5분간 denaturation과 59℃에서 45초간 annealing, 72℃에서 1분간 polymerization을 시행하였다. 다음 주기부터는 94℃에서 45초간 denaturation과 59℃에서 45초간 annealing, 72℃로 1분간 polymerization을 시행하고 이런 과정을 25회 반복하였고 마지막 주기는 94℃에서 45초간 denaturation과 59℃에서 45초간annealing, 72℃에서 10분간 polymerization을 시행하여 DNA를 증폭하였다. 최종 추출물 10 μl를 2% agarose gel에 100 volt로 10분동안 전기영동을 시행한 후 densitometer를 이용하여 각 밴드의 밝기를 측정비교하였다. RNA 의 농도가 20% 이상 증감이 있을 때 RNA양의 변화가 있다고 판정하였다. 결과 PLC-β1와 PLC-γ1의 western immunoblotting 중이진주종상피와 후이개피부에서의 PLC 동위효소의 발현여부를 위해 실시한 western blot 분석 결과 PLC-β1 단백질과 PLC-γ1 단백질에 대해 중이진주종조직, 건선 및 후이개피부에서 40 μg, 60 μg protein/lane의 단백질의 농도에서 양성발현을 보였다. 그러나 중이진주종상피에서의 양성발현은 후이개피부보다 강한 양성발현을 보였다(Fig. 1). PLC 동위효소의 역전사중합효소반응 Western blot 분석에 의하여 확인된 중이진주종에서 PLC-β1과 PLC-γ1의 단백질의 과발현을 검정하고 RNA 단계에서 PLC-β1과 PLC-γ1의 변화를 알아보기 위하여 역전사중합효소반응을 시행한 결과 후이개피부와 중이진주종상피 모두에서 PLC-β1과 PLC-γ1 의 RNA의 발현을 확인할 수 있었으며(Fig. 2), 후이개피부와 중이진주종상피에서 RNA 산물의 밀도측정은 유의한 차이가 없었다(Table 1). 고찰 생체나 세포에서의 생리적 현상은 DAG와 PIP 3가 관여하고 있다.4)7)11) DAG는 PKC를 활성화하는데 활성화된 PKC는 세포내의 대사작용, 세포의 증식 및 분화, 세포의 성장조절, 세포막의 conductance와 transport, 다른 수용체의 강화 또는 하향조절,1) 유전자발현 및 종양화 변환에 중요한 역할을 하며1)14) 세포질의 pH를 증가시켜 정지세포(resting cell)를 유사분열환(mitotic cycle)으로 유도한다.9) 또한 DAG는 중성구와 림파구에 대해 chemoattractant가 있어 이들 세포의 침윤을 일으키는데15) 이러한 과정으로 각질세포의 성장과 분화가 이루어진다.4) 또한 DAG-PKC 경로는 세포의 흥분성을 증가시켜서 다른 신호물질에 대한 세포의 반응성을 변화시킨다. 4)7)11) PIP 3는 세포를 직접 활성화시키는 이차전달물질로, 세포내의 칼슘저장소인 형질내세망의 특정한 수용체에 결합함으로써 저장된 칼슘을 유리시켜 세포질내로 Ca2+을 방출시킴으로써 세포질내 Ca2+을 증가시켜 성장인자에 대한 반응으로써 유전자전사에 관여하여 생리적 현상들을 조절한다.4)7)9)11) 이러한 Ca2+과 DAG를 통한 신호전달은 일시적이지만 다음의 연속되는 신호전달에 필수적이고 synergic effect를 보이며 생체나 세포에서 광범위한 생리적 현상을 조절할 수 있다.4) 현재까지 여러 증거로 보아 세포외부의 신호를 세포내로 전달시키는 과정에서 PLC는 PIP 2를 가수분해하여 위와 같은 여러 가지 조절기능에 관여하는 이차정보전달물질인 PIP 3와 DAG를 생성하는 효소로서 세포내 신호전달기전에 있어서 중추적 역할을 한다.4)6)9)11) PLC는 IP와 polyphosphoinositide에만 특이한 작용을 하나 그밖에 다른 phospholipid에는 작용하지 않고 세포의 성장과 분화를 조절하며 세포내 신호전달체계에 관여하는 것으로 생각되고 있다.14) 그러나 아직까지 세포내에서 PLC의 조절기전에 관해서는 명확하게 알려져 있지 않다. PLC 동위효소는 조직에 따라 다른 분포를 보이지만 각 동위효소의 생리적 차이는 확실히 밝혀지지는 않았으나 각각의 동위효소는 G결합단백질의 여러 아형과 tyrosine kinase의 활성을 통해서 서로 다른 기전에 의해 조절된다.6)8)10)11) 현재 PLC-β1은 G-단백질 중 Gq가 연관되어 있고11) PLC-γ1은 EGFR이나 PDGFR와 같은 receptor protein tyrosine kinase의 기질로6)9)14) 크게 3가지의 방식으로 조절된다. 첫째, PLC-γ1내의 tyrosine 잔기의 인산화로 TGF-α, PDGFR, EGFR는 PLC-γ1의 tyrosine 잔기중 Tyr-472, Tyr-771, Tyr-783, Tyr-1253에 인산화를 유발하여8) PLC를 활성화하는데 Tyr-783의 인산화가 PLC-γ1의 활성에 필수적인 과정이다.6)8)9) 둘째, 세포외부의 칼슘에 의한 PLC-γ1의 활성으로 PLC-γ1의 tyrosine 잔기의 인산화보다 tyrosine kinase의 활성조절로 이루어지는 또 다른 기전으로 세포의 분화과정에 관여한다.10) 그리고 PLC-γ1 내에 존재하는 Src homology2(SH2) domain에서 receptor protein tyrosine kinase와 반응한다.6)8-10) 그리고 배양액 내에 칼슘 농도를 증가시키면 각질형성세포의 분화가 촉진되는데 농도증가에 비례하여 PLC-γ1과 PLC-δ1의 발현이 증가된다.10) 이러한 PLC동위효소의 증가는 mRNA의 증가가 동반되지 않는 것으로 보아 전사후 변경 기전에 의한 것이다.10) 또한 TGF-α, EGFR는 수용체의 intrinsic tyrosine kinase 활성을 증가시켜 IP형성과 칼슘의 유입, Na+/H+의 교환, c-fos와 c-myc의 발현 등으로 DNA 증가와 세포의 분화 및 세포의 종양화변환을 유발하는 것으로 알려져 있다.6) 또한 EGF는 G결합단백질을 통하여 PLC를 활성화시키며6) 증식하는 각질형성세포에서 PLC-γ1은 EGFR에 의해서 활성화된다.4) 그리고 세 번째는 T세포와 관련이 있으며16) 수용체를 거치지 않고 T 세포 항원 수용체(T cell antigen receptor)-CD3 복합체에 tyrosine kinase가 결합함으로써 PLC-γ1는 활성된다.16) 또한 CD3으로 자극을 하면 PLC-γ1의 tyrosine 잔기의 인산화는 이루어지나 PLC-β1의 인산화는 일어나지 않는다.16) 이외에도 PLC는 prostaglandine과 leukotriene의 전구체인 arachidonic acid의 생성에도 관여한다.7) 또한 PLC의 활성으로 DAG를 거쳐 증가된 산물인 PKC에 의해서 되먹임(feedback) 작용으로 PLC의 serine 잔기를 인산화한다. 이로써 PLC-DAG-PKC의 신호전달과정은 조절된다.16) 그리고 각 조직과 세포에서의 EGFR을 통한 신호전달과정이 다르다. 이는 각 조직과 세포의 EGFR이 서로 다른 G결합단백질의 아류형과 결합하여 신호전과정을 이루거나 EGFR이 서로 다른 PLC의 동위효소와 작용하여 각 조직과 세포에 특이적인 PLC동위효소나 PKC동위효소의 발현을 유발한다.4)6) 그리고 흥미로운 것은 G결합단백질을 매개로 EGF를 통한 신호전달기전이 정상세포에도 존재한다는 것이다.6) 과증식 및 비정상적인 성숙(maturation)이 특징인 건선에서는 PLA 2, EGFR의 증가, PLC 활성도의 증가,3) DAG의 증가,4) PIP 2의 가수분해능의 증가7) 및 PKC의 하향조절로17-19) 부적절한 신호를 전달하여 세포의 증식, 성장 및 분화에 이상이 초래되어지는 과정이 병태생리 중 한 기전으로 알려져 있다.4)19) 그리고 악성종양에서 면역조직화학적검사에서 TGF-α, EGF, EGFR, PLC동위효소는 과발현을 하는데 이러한 이상발현이 각 세포들의 통제를 받지 못한 증식과 신체 항상성이 유지되지 못한 결과이다.4)6)10)16)57) 지금까지 알려진 진주종에서의 신호전달로는 정상 피부상피가 고막함몰 등의 변화와 염증에 의해 과증식성향을 갖게 되는 것이 중요과정으로 알려져 있다.2) 이 과정은 상피성장인자, 종양괴사인자-α(TNF-α) 및 TGF-α 등의 여러 cytokine이 고막이나 외이도 상피의 기저세포의 수용기에 coupling되어 유발되는 것으로 알려지고 있다. 이러한 외부의 자극은 기저세포내에서 tyrosine kinase를 활성화시키고, 다시 특정한 신호전달경로를 통해 핵내에서 c-jun이나 c-fos 등의 transcription factor의 발현을 통해 DNA의 변화를 초래하는 것으로 보고되고 있으며2) 이로 인해 세포주기의 변화가 유도되어 세포의 증식도 변하게 되며 이 결과 상피세포는 과증식 성향을 띄게 되어 진주종의 특성을 갖는 것으로 보고되고 있다.20) 그러나 이것은 아직 일부에서는 가설로만 주장되고 있을 뿐 현재까지 이의 입증을 위한 연구가 계속되고 있다. 저자들은 이전 연구의 면역조직화학검사로 중이진주종상피에서 PLC-β1 단백질과 PLC-γ1 단백질의 과발현 및 기저층에서는 PLC-β1을, 기저층의 상부층들 에서는 PLC-β1와 PLC-γ1을 매개로 하는 신호전달과정이 존재한다고 보고하였다.12) 그리고 중이진주종상피에서 PLC 이후의 신호전달과정의 이차전달물질중의 하나인 PKC 동위효소는 체외로 배출되지 못한 각질등의 만성적인 자극으로 인하여 후전사단계에서 하향조절된 현상을 보고 한 바 있다.13) 본 연구는 western blot 분석으로 중이진주종상피층에서 PLC-β1과 PLC-γ1의 단백질의 과발현을 확인하였다. 이러한 결과는 중이진주종에서 만성적인 자극으로 인하여 지속적인 PKC 자체의 음성되먹임으로 PKC의 하향조절현상으로 세포에서 PKC는 소실되어 PLC의 serine 잔기를 인산화하는 기능을 상실됨으로써 PLC의 과발현을 초래하는 것으로 생각된다. 이는 중이진주종상피에서의 tyrosine kinase의 활성을 간접적으로 시사해주는 결과이다. 그리고 본 연구에서 중이진주종상피층에서 PLC-β1과 PLC-γ1의 RNA의 변화가 없음을 알 수 있었다. 이로써 Punnonen10)의 결과와 같이 중이진주종상피층에서 PLC 동위효소의 단백질의 과발현은 RNA의 증가가 동반되지 않는 것을 보아 PLC 동위효소의 변화는 후전사단계에서 발생하는 것으로 생각되며 이는 중이진주종의 형성에 2가지의 가능성을 제시하는데 첫째로는 후이개피부상피에서 PLC 동위효소의 gene에서 단백질로의 전사단계나 후전사단계에서 PLC 단백질의 발현을 막는 어떠한 인자가 존재하여 PLC를 매개로 하는 과증식의 신호전달과정을 방지할 수 있으나 중이진주종에서 이러한 인자의 소실로 PLC 단백질의 발현으로 과증식이 일어 날 수 있다는 것과, 둘째로 중이진주종상피층에서 후이개상피보다 활성형의 PLC 동위효소의 단백질이 많아 PLC를 매개로 하는 신호전달과정이 일어날 수 있다는 것이다. 결론 중이진주종은 비정상적으로 과각화증을 일으키는 질환으로 그 발생기전이나 병태생리에 관한 명확한 기전은 아직 밝혀지지 않은 상태이며 중이진주종에서의 신호전달체계에 대한 관심은 최근의 일이다. 본 저자들은 중이진주종에서 EGFR이나 PDGFR와 같은 receptor protein tyrosine kinase의 기질로 PIP 2 를 PIP 3와 DAG로 가수분해하여 PKC활성 및 Ca2+의 대사조절, c-fos와 c-myc의 발현, MAP kinase의 활성 등의 DNA증가와 세포의 분화 및 세포의 종양화변환을 유발하고 arachidonic acid의 생성에도 관여하는 PLC의 역할을 western blot 분석, 역전사효소중합반응 및 densitometry를 시행하여 다음과 같은 결과를 얻었다. 중이진주종상피층에서 PLC 동위효소 단백질은 과발현하였고 PLC 동위효소 RNA는 변화가 없었다. 이상의 결과로 중이진주종상피층에는 후전사단계에서 과발현되는 PLC 동위효소를 통한 신호전달체계가 존재함을 알 수 있었다. 이러한 결과는 중이진주종상피에서의 tyrosine kinase의 활성을 간접적으로 시사해주며 중이진주종상피층은 PLC 동위효소를 매개로 하는 신호전달과정을 통하여 과증식을 유발함을 알 수 있었다.
REFERENCES
1) Min WS, Jung HS, Park JY, Jun BH. Immunohistochemical study on the expression of proliferative markers of the squqamous epithelium of the cholesteatoma. Korean J Otolaryngol 1995;38:1884-900. 2) Shideo H, Huang CC. Expression of c-jun and p53 proteins in human middle ear cholesteatoma: Relationship to keratinocyte proliferation, differentiation, and programmed cell death. Laryngoscope 1993;105:1232-7. 3) Bartel RA, Marcelo CL, Voorhees JJ. Partial charaterization of phospholipase C activity in normal, psoriatic uninvolved and lesional epidermis. J Invest Dermatol 1987;88:447-51. 4) Choi JH. Signal transduction in keratinocyte. Korean Journal of Investigative Dermatology 1996;3:99-110. 5) Nishizuka Y. Studies and perspectives of protein kinase C. Science. Wash DC 1986;233:305-12. 6) Arteaga CL, Johnson MD, Todderud G, Coffey RJ, Carpenter G, Page DL. Elevated content of the tyrosine kinase substrate phospholipase C-γ1 in primary human beast carcinomas. Proc Natl Acad Sci USA 1991;88:10435-9. 7) Fisher GJ, Talwar HS, Baldassare JJ, Henderson PA, Voorhees JJ. Increased phospholipase C-catalyzed hydrolysis of phosphatidylinositol-4, 5-bisphosphate and 1,2-sn-diacylglycerol content in psoriatic involved compared to uninvolved and normal epidermis. J Invest Dermatol 1990;95:428-35. 8) Kim HK, Kim JW, Zilberstein A, Margolis B, Kim SG, Schlessinger J, et al. PDGF stimulation of inositol phospholipid hydrolysis requires PLC-γ1 phosphorylation on tyrosine residues 783 and 1254. Cell 1991;65:435-41. 9) Martin TFJ. Receptor regulation of phosphoinositi2.dase C. Pharmacol Ther 1991;49:329-45. 10) Punnonen K, Denning M, Lee E, Li L, Rhee SG, Yuspa SH. Keratinocyte differentiation is associated with changes in the expression and regulation of phospholipase C isozymes. J Invest Dermatol 1993;101:719-26. 11) Rhee SG, Choi KD. Regulation of inositol phospholipid-specific phospholipase C isoenzymes. J Biol Chem 1992;267:12393-6. 12) Song YH, Hong NP, Lee DY, Kim YD, Ahn HW, Cha CI. Expression of phospholipase C-β1 and phospholipase C-γ1 on cholesteatoma. In press. 13) Hong NP, Park CS, Song YH, Byun JY, Ahn HW, Cha CI. Down regulation of PKC isozymes on cholesteatoma. In press. 14) Rhee SG, Suh PG, Ryu SH, Lee SY. Studies of inositol phospholipid-specific phospholipase C. Science 1989;244:546-50. 15) Wright TM, Hoffman RD, Nishijima J, Jakoi L, Snygerman R, Shin HS. Leukocyte chemoattraction by 1,2-diacylglycerol. Proc Natl Acas Sci 1988;85:1869-73. 16) Park DJ, Rho HW, Rhee SG. CD3 stimulation causes phosphorylation of phospholipase C γ1 on serine and tyrosine residures in a human T-cell line. Proc Natl Acad USA 1991;88:5453-6. 17) Fisher GJ, Tavakkol A, Lach K, Burns D, Basta P, Loomis C, et al. Differential expression of protein kinase C isoenzymes in normal and psoriatic skin: Reduced expression of protein kinase C-beta in psoriasis. J Invest Dermatol 1993;101:553-9. 18) Horn F, Marks F, Fisher GJ, Marcelo CL, Voorhees JJ. Decreased protein kinase Cactivity in Psoriatic versus normal epidermis. J Invest Dermatol 1987;88:220-2. 19) Nishizuka Y. Intracellular signalling by hydrolysis of phospholipids and activation ofprotein kinase C. Science 1992;258:607-14. 20) Chao WY, Huang CC. An immunohistochemical study of cytokeratin expression in human middle ear cholesteatoma. Arch Otorhinolaryngol 1989;246:37-42.


ABOUT
ARTICLES

Browse all articles >

ISSUES
TOPICS

Browse all articles >

AUTHOR INFORMATION
Editorial Office
Department of Otorhinolaryngology-Head and Neck Surgery, Seoul St. Mary’s Hospital
#505 Banpo-dong, Seocho-gu, Seoul 06591, Korea
Tel: +82-2-2258-6213    Fax: +82-2-595-1354    E-mail: khpent@catholic.ac.kr                

Copyright © 2022 by The Korean Audiological Society and Korean Otological Society. All rights reserved.

Developed in M2PI

Close layer
prev next